Command Options

Every SEGUL task runs as a command and a subcommand, followed by options. Most tasks share the same input, output, and format options, so once you learn them for one task, they work for the rest. This page covers the shared options. Options specific to a task are listed on its own page.

1. Read a command

Without --output, SEGUL writes to a default folder named after the task, such as Align-Concat.

The program is segul on Linux, macOS, and Windows Subsystem for Linux, and segul.exe in the Windows Command Prompt. SEGUL keeps its options consistent:

Part	Form	Example
Long option	Two dashes, followed by a value	--dir alignments/
Short option	One dash. Not every option has one	-d alignments/
Flag	No value. Turns a setting on	--force
= option	Value in single or double quotes	--re="^Genus"

Every short option also has a long form. Some options, such as --datatype, only have a long form.

2. Choose a command

SEGUL groups its tasks by the kind of input they take. Each command has its own subcommands:

Command	Input	Subcommands
align	Alignments	concat, convert, distance, filter, split, summary, trim, unalign
sequence	Alignments or sequences	add, extract, filter, id, remove, rename, translate, transpose
partition	Partition files	convert
maf	Multiple alignment format	convert, summary
read	FASTQ reads	summary
contig	Contigs	summary

3. Get help

The help output lists every option of a task, with its default and allowed values:

segul --help                         # All commands
segul align --help                   # Subcommands of a command
segul align concat --help            # Options of a task
segul --version                      # Installed version

Use -h and -V as short forms of --help and --version. The options on these pages match SEGUL v0.24.0.

4. Shared options

Option	Description	Available in
-d, --dir	Directory with the input files. Searched recursively	All, except align split and partition convert
-i, --input	Input files. Allows wildcards	All
-f, --input-format	Input format. Default: auto	All, except maf
--datatype	Data type: dna (default), aa, or ignore	align, sequence, partition
-o, --output	Output directory. Default: named after the task	All
-F, --output-format	Output sequence format	Tasks that write sequences
--prefix	Prefix of the output files	Tasks that write a single file or summary
--force	Overwrite an existing output directory without asking	All
--log	Log file path. Default: segul.log	All
-h, --help	Print help	All

Input

Use one of the two input options:

--dir

Point SEGUL to a directory. It finds every matching file in the directory and its subdirectories, and writes the directory path to the log:

segul align summary --dir alignments/

Most tasks should use --dir. Versions before v0.19.0 also need --input-format with --dir.

--input

List files, or let the shell expand a wildcard. Use it for nested folders or to pick files by name:

segul align summary --input parent_dir/*/contig.fasta

SEGUL detects the format of each file from its extension. For extensions it does not know, such as .aln, set the format:

segul align summary --input alignments/*.aln --input-format fasta

Note

Wildcards in the Windows Command Prompt only match files, not directories.

Input format

SEGUL detects the input format from the file extension, so most commands need no --input-format. Set it for unusual extensions. Interleaved and sequential files are both read.

Command	Formats
align, sequence, partition	auto (default), fasta, nexus, phylip
read	auto (default), fastq, gzip
contig	auto (default), fasta, gzip

read commands detect gzip and BGZF compression from the file content, so the input format only decides which files -d finds.

maf commands read .maf and .maf.gz files and take no input format.

:::note SEGUL reads relaxed PHYLIP, where names and sequences are separated by spaces and names can be any length. Strict PHYLIP, with blocks of ten characters separated by spaces, is not supported:

3 20
Seq1    ATCGATCGATATCGATCGAT
Seq2    ATCGATCGATATCGATCGAT
Seq3    ATCGATCGATATCGATCGAT

:::

Data types

Sequences are DNA by default. Use --datatype aa for amino acid sequences. SEGUL then checks that every sequence holds only valid IUPAC characters.

Value	Use for
dna	DNA sequences (default)
aa	Amino acid sequences
ignore	Skip the character check. Up to 40% faster

--datatype ignore is safe when:

1. The sequences are DNA.
2. The sequences are amino acids, and either the input or the output is not NEXUS.
3. You have already run the same dataset through SEGUL, or you are sure it holds only IUPAC characters and no spaces in sequence names.

Tasks that compute statistics, such as align summary and align distance, need dna or aa.

Output

Every task writes to its own default directory in the current working directory, such as Align-Concat for align concat. Use --output or -o to choose another directory:

segul align concat --dir alignments/ --output concat

If the directory exists, SEGUL asks before removing it. Add --force to remove it without asking. Use --force on HPC clusters and in scripts, where no one can answer the prompt.

Output format

Tasks that write sequences take --output-format or -F. Most default to nexus. Check each task's default with --help.

Sequential	Interleaved
nexus	nexus-int
phylip	phylip-int
fasta	fasta-int

align unalign, sequence add, and sequence transpose write FASTA only: fasta or fasta-int.

Prefix and log

--prefix sets the name of the output files of tasks that write a single file or a summary, such as align concat, align summary, and read summary. sequence id also takes -p as a short form.

SEGUL records every run in segul.log in the current working directory. Use --log to write it elsewhere. See Log file.

5. Find task options

Each task page ends with an All options table that lists the shared and task-specific options together.

Alignment concatenationsegul align concat

Alignment filteringsegul align filter

Sequence renamingsegul sequence rename

MAF conversionsegul maf convert